Data Link 7
Plasmids and plasmid constructions used in
Kalaitzidis D, Ok J, Sulak L II, Starczynowski DT & Gilmore TD. 2004. Characterization of a human REL-estrogen receptor fusion protein with a reverse conditional transforming activity in chicken spleen cells. Oncogene 23 7580-7587
Intermediate Subcloning Plasmids
pHE14: C-terminal half of the human Estrogen Receptor (Ligand Binding Domain [LBD]) with a 5′ Kozak’s consensus leader sequence and nucleotides encoding 3 extra amino acids before amino acids 282-595 of human ER (Kumar et al., 1986)
pSL1180-DEcoRV-SmaI: pSL1180 digested with EcoRV and SmaI, and then recircularized pSL1180-DEcoRV-SmaI-ER LBD of hER; an EcoRI fragment from HE14 was subcloned into the EcoRI site of pSL1180-DEcoRV-SmaI
pSL1180-DEcoRV-SmaI-3’RELDD424-490-ER: Contains approx. the 3′ 500 nucleotides of RELDD424-490 fused at the 3′ to nucleotides encoding the LBD of hER. The 3′ 500 nt of RELDD424-490 were PCR amplified with BamHI containing primers*, digested with BamHI, and subcloned into the BamHI site of pSL1180-DEcoRV-SmaI- hER to create an in-frame fusion
pSL1180-RELD424-490: pSL1180 containing RELDd424-490. An XbaI/XhoI fragment was subcloned from pGEM4-RELD424-490 (Starczynowski et al, 2003) into XbaI/XhoI cut pSL1180
Spleen Necrosis Virus-Based Avian Retroviral Vectors
JD214BS+: Spleen necrosis virus vector (Sif et al, 1993)
JD-Hu-c-Rel: JD214BS+ containing human REL subcloned as an XbaI-XhoI fragment into JD214BS+ digested with XbaI-SalI (Gilmore et al, 2001)
JD-RELD424-490: Spleen necrosis virus vector for expressing RELDð424-490. JD214BS+ containing human RELDð424-490 subcloned as an XbaI-XhoI fragment into JD214BS+ digested with XbaI-SalI (Starczynowski et al, 2003)
JD-RELD424-490-ER: Spleen necrosis virus vector for expressing full-length RELD424-490 fused to the LBD of hER. An ApaI/ClaI fragment from pSL1180-DEcoRV-SmaI-3’RELDð424-490-ER was subcloned into ApaI/ClaI digested JD-Hu-c-Rel to replace 3′ sequences from full-length REL with 3′ sequences from RELD424-490-ER
JD-v-Rel-ER: v-Rel fused to the LBD of hER (Capobianco & Gilmore, 1993)
SW253: Replication-competent Rev-A avian helper virus (Watanabe & Temin, 1983)
Expression Vectors
pcDNA3.1 (-) : CMV promoter-driven expression vector (Invitrogen)
pcDNA3.1(-)-RELD424-490: pcDNA3.1(-) containing RELD424-490 subcloned as an XbaI/XhoI fragment into XbaI/XhoI-digested pcDNA3.1(-)
pcDNA3.1(-)-3’RELD424-490-ER: pcDNA3.1(-) containing the 3′ sequences of RELD424-490-ER. An ApaI/partial HindIII fragment of RELDð424-490-ER was subcloned into the ApaI/HindIII site of pcDNA3.1(-)
pcDNA3.1(-)-RELD424-490-ER: pcDNA3.1(-) containing full-length RELD424-490-ER. A 5′ ApaI fragment of REL was subcloned into the ApaI site of pcDNA3.1(-)-3’RELD424-490-ER.
pSG424: Expression plasmid containing GAL4 DNA-binding domain (DBD; aa 1-147) upstream of MCS and controlled by SV40 promoter (Sadowski & Ptashne, 1989)
pSG-3’RELD424-490: RELD424-490 (aa 278-423,491-587) fused to GAL4 DBD;
pBluescript KS+-RELD424-490 digested with BamHI-KpnI was subcloned into BamHI-KpnI sites in pSG424 (Starczynowski et al, 2003)
pSG-3’RELD424-490-ER RELD424-490 (aa 278-423,491-587)-ER fused to GAL4 DBD; pSL1180-DEcoRV-SmaI-3’RELD424-490-ER was digested with ApaI/KpnI and the fragment was subcloned into ApaI/KpnI-digested pSG-3’RELD424-490
pGEXkg-REL: REL (aa 1-323 with artificial stop codon) fused to the C-terminus of GST. A ~1 kbp fragment of REL was amplified from pGEM4-REL using a forward SP6 primer and a HindIII site/artificial stop codon containing reverse primer (GST primer, see below). The PCR fragment was digested with NcoI/HindIII and subcloned into NcoI/HindIII digested pGEXkg.
*Primers for REL-ER Fusion Construction
Forward: 5′ CGCGGATCCGCGGCAGAATCCTACTATCCCTCACC3′
Reverse: 5′ CGGGATCCCGTACTTGAAAAAATTCATATGGAAAGGAG3′
GST primer Reverse: 5′ CCCAAGCTTTTATCCAATTGAACCGAGAG3′
References
Capobianco AJ & TD Gilmore (1993) A conditional mutant of vRel containing sequences from the human estrogen receptor. Virology 193:160-170
Gilmore TD, C Cormier, J Jean-Jacques & M-E Gapuzan (2001) Malignant transformation of primary chicken spleen cells by human transcription factor c-Rel. Oncogene 20: 7098-7103
Kumar V, Green S, Staub A & Chambon P (1986) Localisation of the oestradiol-binding and putative DNA-binding domains of the human oestrogen receptor. EMBO Journal 5: 2231-2236
Sadowski I & M Ptashne (1989) A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Research 17: 7539
Schatzle JD, J Kralova & HR Bose Jr (1995) Avian IkBa is transcriptionally induced by c-Rel and v-Rel with different kinetics. Journal of Virology 69: 5383-5390
Sif S, AJ Capobianco & TD Gilmore (1993) The v-Rel oncoprotein increases expression from Sp1 site-containing promoters in chicken embryo fibroblasts. Oncogene 8: 2501-2509
Starczynowski DT, JG Reynolds & TD Gilmore. (2003) Deletion of either C-terminal transactivation subdomain enhances the in vitro transforming activity of human transcription factor REL in chicken spleen cells. Oncogene 22: 6928-6936
Watanabe S & HM Temin (1983) Construction of a helper cell line for avian reticuloendotheliosis virus cloning vectors. Molecular and Cellular Biology 3: 2241-2249
