Data Link 10

APPENDIX

Plasmids and oligonucleotides used in

Herscovitch M, W Comb, T Ennis, K Coleman, S Yong, B Armstead, D Kalaitzidis, S Chandani & TD Gilmore. 2007. Intermolecular disulfide bond formation in the NEMO dimer requires Cys54 and Cys347. Biochemical and Biophysical Research Communications 367: 103-108

Intermediate Subcloning Plasmids

pGEM4   (Promega)

pGEM4-NEMO:  pcDNA-6×Myc-NEMO was digested with EcoRI/XbaI and the fragment was subcloned into the corresponding sites of pGEM4

pGEM4-NEMO-C54/347A:  pcDNA-6×Myc-NEMO-C54/347A was digested with EcoRI/XbaI and the fragment was subcloned into the corresponding sites of pGEM4

Retroviral Vectors

pBABE:  Retroviral vector containing the puromycin resistance cassette (Morgenstern and Land, 1990)

pBABE-NEMO: pGEM4-NEMO was digested with EcoRI/SalI and the digested fragment was subcloned into the corresponding sites of pBABE

pBABE-NEMO-C54/347A: pGEM4-NEMO-C54/347A was digested with EcoRI/SalI and thedigested fragment was subcloned into the corresponding sites of pBABE

Expression Vectors

pcDNA-6×Myc-NEMO: Gift of S.Miyamoto (University of Wisconsin, Madison)

pcDNA-6×Myc-NEMO-C54A: Site-directed mutagenesis was performed using two synthetic complementary oligonucleotide primers containing the relevant point mutation and two flanking primers (5’ and 3’).  The final PCR product was digested with HindIII and EcoRV and used to replace the corresponding HindIII/EcoRV fragment in pcDNA-6×Myc-NEMO

pcDNA-6×Myc-NEMO-C347A: Site-directed mutagenesis was performed as described above. The final PCR product was digested with EcoRV/XbaI and used to replace the corresponding EcoRV/XbaI fragment in pcDNA-6×Myc-NEMO

pcDNA-6×Myc-NEMO-C54/347A:  pcDNA-6×Myc-NEMO-C347A was digested with EcoRV/XbaI and this fragment was used to replace the corresponding EcoRV/XbaI fragment in the pcDNA-6×Myc-NEMO-C54A plasmid

pcDNA3-FLAG: Gift of Bakary Sylla (Lyons, France)

pcDNA3-FLAG-NEMO:  Gift of Sankar Ghosh (Yale University)

pcDNA3-FLAG-NEMO-C54A:  PCR amplification of pcDNA-6×Myc-NEMO-C54A  was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.

pcDNA3-FLAG-NEMO-C347A:  PCR amplification of pcDNA-6×Myc-NEMO-C347A  was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.

pcDNA3-FLAG-NEMO-C54/347A: PCR amplification of pcDNA-6×Myc-NEMO-C54/347A  was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.

Reporter Plasmids

pcDNA-3×kB-luciferase: kB site-luciferase reporter plasmid (Starczynowski et al., 2007)

pRSV-bgal: Expression of the b-galactosidase gene driven by the Rous sarcoma virus promoter. Gift of Dr Douglas Faller (Boston University Medical School)

Primers used for amplification of NEMO from pcDNA-6×Myc

FLAG-NEMO-EcoRI-FOR	GATAGAATTCAAATAGGCACCTCTGGAAGAGC
FLAG-NEMO-BamHI-REV	AATGGATCCCTACTCAATGCACTCCATGACATG

*Restriction sites in bold

Primers used for site-directed mutagenesis of pcDNA-6×Myc-NEMO

NEMO-C54A-FOR	GCGCGCCCTGGAGGAGAATCAAG
NEMO-C54A-REV	TGATTCTCCTCCAGGGCGCGC
NEMO-C347A-FOR	AAGGCCAGCGCTCAGGAG
NEMO-C347A-REV	CTCCTGAGCGCTGGCCTTCC

Mutant codons in bold

References

Morgenstern JP, Land H. (1990). Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell. Nucleic Acids Research 18: 3587-3596

Starczynowski DT, H Trautmann, C Pott, L Harder, N Arnold, JA Africa, JR Leeman, R Siebert & TD Gilmore. (2007). Mutation of an IKK phosphorylation site within the transactivation domain of REL in two patients with B-cell lymphoma enhances REL’s in vitro transforming activity. Oncogene 26: 2685-2694