Data Link 10
APPENDIX
Plasmids and oligonucleotides used in
Herscovitch M, W Comb, T Ennis, K Coleman, S Yong, B Armstead, D Kalaitzidis, S Chandani & TD Gilmore. 2007. Intermolecular disulfide bond formation in the NEMO dimer requires Cys54 and Cys347. Biochemical and Biophysical Research Communications 367: 103-108
Intermediate Subcloning Plasmids
pGEM4 (Promega)
pGEM4-NEMO: pcDNA-6×Myc-NEMO was digested with EcoRI/XbaI and the fragment was subcloned into the corresponding sites of pGEM4
pGEM4-NEMO-C54/347A: pcDNA-6×Myc-NEMO-C54/347A was digested with EcoRI/XbaI and the fragment was subcloned into the corresponding sites of pGEM4
Retroviral Vectors
pBABE: Retroviral vector containing the puromycin resistance cassette (Morgenstern and Land, 1990)
pBABE-NEMO: pGEM4-NEMO was digested with EcoRI/SalI and the digested fragment was subcloned into the corresponding sites of pBABE
pBABE-NEMO-C54/347A: pGEM4-NEMO-C54/347A was digested with EcoRI/SalI and thedigested fragment was subcloned into the corresponding sites of pBABE
Expression Vectors
pcDNA-6×Myc-NEMO: Gift of S.Miyamoto (University of Wisconsin, Madison)
pcDNA-6×Myc-NEMO-C54A: Site-directed mutagenesis was performed using two synthetic complementary oligonucleotide primers containing the relevant point mutation and two flanking primers (5’ and 3’). The final PCR product was digested with HindIII and EcoRV and used to replace the corresponding HindIII/EcoRV fragment in pcDNA-6×Myc-NEMO
pcDNA-6×Myc-NEMO-C347A: Site-directed mutagenesis was performed as described above. The final PCR product was digested with EcoRV/XbaI and used to replace the corresponding EcoRV/XbaI fragment in pcDNA-6×Myc-NEMO
pcDNA-6×Myc-NEMO-C54/347A: pcDNA-6×Myc-NEMO-C347A was digested with EcoRV/XbaI and this fragment was used to replace the corresponding EcoRV/XbaI fragment in the pcDNA-6×Myc-NEMO-C54A plasmid
pcDNA3-FLAG: Gift of Bakary Sylla (Lyons, France)
pcDNA3-FLAG-NEMO: Gift of Sankar Ghosh (Yale University)
pcDNA3-FLAG-NEMO-C54A: PCR amplification of pcDNA-6×Myc-NEMO-C54A was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.
pcDNA3-FLAG-NEMO-C347A: PCR amplification of pcDNA-6×Myc-NEMO-C347A was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.
pcDNA3-FLAG-NEMO-C54/347A: PCR amplification of pcDNA-6×Myc-NEMO-C54/347A was performed using oligonucleotides with inserted EcoRI and BamHI sites and the PCR product was further digested with EcoRI/BamHI. The digested fragment was then subcloned into the corresponding sites of pcDNA-FLAG.
Reporter Plasmids
pcDNA-3×kB-luciferase: kB site-luciferase reporter plasmid (Starczynowski et al., 2007)
pRSV-bgal: Expression of the b-galactosidase gene driven by the Rous sarcoma virus promoter. Gift of Dr Douglas Faller (Boston University Medical School)
Primers used for amplification of NEMO from pcDNA-6×Myc
FLAG-NEMO-EcoRI-FOR | GATAGAATTCAAATAGGCACCTCTGGAAGAGC |
FLAG-NEMO-BamHI-REV | AATGGATCCCTACTCAATGCACTCCATGACATG |
*Restriction sites in bold
Primers used for site-directed mutagenesis of pcDNA-6×Myc-NEMO
NEMO-C54A-FOR | GCGCGCCCTGGAGGAGAATCAAG |
NEMO-C54A-REV | TGATTCTCCTCCAGGGCGCGC |
NEMO-C347A-FOR | AAGGCCAGCGCTCAGGAG |
NEMO-C347A-REV | CTCCTGAGCGCTGGCCTTCC |
Mutant codons in bold
References
Morgenstern JP, Land H. (1990). Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell. Nucleic Acids Research 18: 3587-3596
Starczynowski DT, H Trautmann, C Pott, L Harder, N Arnold, JA Africa, JR Leeman, R Siebert & TD Gilmore. (2007). Mutation of an IKK phosphorylation site within the transactivation domain of REL in two patients with B-cell lymphoma enhances REL’s in vitro transforming activity. Oncogene 26: 2685-2694