{"id":583,"date":"2011-04-26T15:26:02","date_gmt":"2011-04-26T19:26:02","guid":{"rendered":"https:\/\/www.bu.edu\/nf-kb\/?page_id=583"},"modified":"2011-04-28T18:50:26","modified_gmt":"2011-04-28T22:50:26","slug":"data-link-7","status":"publish","type":"page","link":"https:\/\/www.bu.edu\/nf-kb\/the-gilmore-lab\/data-link-7\/","title":{"rendered":"Data Link 7"},"content":{"rendered":"

Plasmids and plasmid constructions used in<\/strong><\/h2>\n

Kalaitzidis D, Ok J, Sulak L II, Starczynowski DT & Gilmore TD. 2004. Characterization of a human REL-estrogen receptor fusion protein with a reverse conditional transforming activity in chicken spleen cells. Oncogene 23 7580-7587<\/p>\n

Intermediate Subcloning Plasmids<\/h3>\n

pHE14: C-terminal half of the human Estrogen Receptor (Ligand Binding Domain [LBD]) with a 5′ Kozak’s consensus leader sequence and nucleotides encoding 3 extra amino acids before amino acids 282-595 of human ER (Kumar et al., 1986)<\/p>\n

pSL1180-DEcoRV-SmaI:\u00a0 pSL1180 digested with EcoRV and SmaI, and then recircularized pSL1180-DEcoRV-SmaI-ER LBD of hER; an EcoRI fragment from HE14 was subcloned into the EcoRI site of pSL1180-DEcoRV-SmaI<\/p>\n

pSL1180-DEcoRV-SmaI-3’RELDD424-490-ER:\u00a0 Contains approx. the 3′ 500 nucleotides of RELDD424-490 fused at the 3′ to nucleotides encoding the LBD of hER. The 3′ 500 nt of RELDD424-490 were PCR amplified with BamHI containing primers*, digested with BamHI, and subcloned into the BamHI site of pSL1180-DEcoRV-SmaI- hER to create an in-frame fusion<\/p>\n

pSL1180-RELD424-490:\u00a0\u00a0 pSL1180 containing RELDd424-490. An XbaI\/XhoI fragment was subcloned from pGEM4-RELD424-490 (Starczynowski et al, 2003) into XbaI\/XhoI cut pSL1180<\/p>\n

Spleen Necrosis Virus-Based Avian Retroviral Vectors<\/strong><\/p>\n

JD214BS+:\u00a0 Spleen necrosis virus vector (Sif et al, 1993)<\/p>\n

JD-Hu-c-Rel:\u00a0\u00a0\u00a0\u00a0JD214BS+ containing human REL subcloned as an XbaI-XhoI fragment into JD214BS+ digested with XbaI-SalI (Gilmore et al, 2001)<\/p>\n

JD-RELD424-490:\u00a0\u00a0 Spleen necrosis virus vector for expressing RELD\u00f0424-490. JD214BS+ containing\u00a0human RELD\u00f0424-490 subcloned as an XbaI-XhoI fragment into JD214BS+ digested with XbaI-SalI (Starczynowski et al, 2003)<\/p>\n

JD-RELD424-490-ER:\u00a0 Spleen necrosis virus vector for expressing full-length RELD424-490 fused to the LBD of hER. An ApaI\/ClaI fragment from pSL1180-DEcoRV-SmaI-3’RELD\u00f0424-490-ER was subcloned into ApaI\/ClaI digested JD-Hu-c-Rel to replace 3′ sequences from full-length REL with 3′ sequences from RELD424-490-ER<\/p>\n

JD-v-Rel-ER:\u00a0 v-Rel fused to the LBD of hER (Capobianco & Gilmore, 1993)<\/p>\n

SW253: \u00a0Replication-competent Rev-A avian helper virus (Watanabe & Temin, 1983)<\/p>\n

Expression Vectors<\/strong><\/p>\n

pcDNA3.1 (-) :\u00a0 CMV promoter-driven expression vector (Invitrogen)<\/p>\n

pcDNA3.1(-)-RELD424-490:\u00a0\u00a0 pcDNA3.1(-) containing RELD424-490 subcloned as an XbaI\/XhoI fragment into XbaI\/XhoI-digested pcDNA3.1(-)<\/p>\n

pcDNA3.1(-)-3’RELD424-490-ER:\u00a0 pcDNA3.1(-) containing the 3′ sequences of RELD424-490-ER. An ApaI\/partial HindIII fragment of RELD\u00f0424-490-ER was subcloned into the ApaI\/HindIII site of pcDNA3.1(-)<\/p>\n

pcDNA3.1(-)-RELD424-490-ER:\u00a0 pcDNA3.1(-) containing full-length RELD424-490-ER. A 5′ ApaI fragment of REL was subcloned into the ApaI site of pcDNA3.1(-)-3’RELD424-490-ER.<\/p>\n

pSG424:\u00a0 Expression plasmid containing GAL4 DNA-binding domain (DBD; aa 1-147) upstream of MCS and controlled by SV40 promoter (Sadowski & Ptashne, 1989)<\/p>\n

pSG-3\u2019RELD424-490: \u00a0RELD424-490 (aa 278-423,491-587) fused to GAL4 DBD;<\/p>\n

pBluescript KS+-RELD424-490 digested with BamHI-KpnI was subcloned into BamHI-KpnI sites in\u00a0pSG424 (Starczynowski et al, 2003)<\/p>\n

pSG-3\u2019RELD424-490-ER RELD424-490 (aa 278-423,491-587)-ER fused to GAL4 DBD; pSL1180-DEcoRV-SmaI-3’RELD424-490-ER was digested with ApaI\/KpnI and the fragment was subcloned into ApaI\/KpnI-digested pSG-3\u2019RELD424-490<\/p>\n

pGEXkg-REL: REL (aa 1-323 with artificial stop codon) fused to the C-terminus of GST. A ~1 kbp fragment of REL was amplified from pGEM4-REL using a forward SP6 primer and a HindIII site\/artificial stop codon containing reverse primer (GST primer, see below). The PCR fragment was digested with NcoI\/HindIII and subcloned into NcoI\/HindIII digested pGEXkg.<\/p>\n

*Primers for REL-ER Fusion Construction<\/p>\n

Forward: 5′ CGCGGATCCGCGGCAGAATCCTACTATCCCTCACC3′<\/p>\n

Reverse: 5′ CGGGATCCCGTACTTGAAAAAATTCATATGGAAAGGAG3′<\/p>\n

GST primer Reverse: 5′ CCCAAGCTTTTATCCAATTGAACCGAGAG3′<\/p>\n

References<\/strong><\/p>\n

Capobianco AJ & TD Gilmore (1993) A conditional mutant of vRel containing sequences from the human estrogen receptor. Virology 193:160-170<\/p>\n

Gilmore TD, C Cormier, J Jean-Jacques & M-E Gapuzan (2001) Malignant transformation of primary chicken spleen cells by human transcription factor c-Rel. Oncogene 20: 7098-7103<\/p>\n

Kumar V, Green S, Staub A & Chambon P (1986) Localisation of the oestradiol-binding and putative DNA-binding domains of the human oestrogen receptor. EMBO Journal 5: 2231-2236<\/p>\n

Sadowski I & M Ptashne (1989) A vector for expressing GAL4(1-147) fusions in mammalian cells. Nucleic Acids Research 17: 7539<\/p>\n

Schatzle JD, J Kralova & HR Bose Jr (1995) Avian IkBa is transcriptionally induced by c-Rel and v-Rel with different kinetics. Journal of Virology 69: 5383-5390<\/p>\n

Sif S, AJ Capobianco & TD Gilmore (1993) The v-Rel oncoprotein increases expression from Sp1 site-containing promoters in chicken embryo fibroblasts. Oncogene 8: 2501-2509<\/p>\n

Starczynowski DT, JG Reynolds & TD Gilmore. (2003) Deletion of either C-terminal transactivation subdomain enhances the in vitro transforming activity of human transcription factor REL in chicken spleen cells. Oncogene 22: 6928-6936<\/p>\n

Watanabe S & HM Temin (1983) Construction of a helper cell line for avian reticuloendotheliosis virus cloning vectors. Molecular and Cellular Biology 3: 2241-2249<\/p>\n","protected":false},"excerpt":{"rendered":"

Plasmids and plasmid constructions used in Kalaitzidis D, Ok J, Sulak L II, Starczynowski DT & Gilmore TD. 2004. Characterization of a human REL-estrogen receptor fusion protein with a reverse conditional transforming activity in chicken spleen cells. Oncogene 23 7580-7587 Intermediate Subcloning Plasmids pHE14: C-terminal half of the human Estrogen Receptor (Ligand Binding Domain [LBD]) […]<\/p>\n","protected":false},"author":4258,"featured_media":0,"parent":337,"menu_order":17,"comment_status":"closed","ping_status":"open","template":"","meta":[],"_links":{"self":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/583"}],"collection":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/users\/4258"}],"replies":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/comments?post=583"}],"version-history":[{"count":3,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/583\/revisions"}],"predecessor-version":[{"id":585,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/583\/revisions\/585"}],"up":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/337"}],"wp:attachment":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/media?parent=583"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}