{"id":571,"date":"2011-04-26T15:19:14","date_gmt":"2011-04-26T19:19:14","guid":{"rendered":"https:\/\/www.bu.edu\/nf-kb\/the-gilmore-lab\/data-link-14\/"},"modified":"2011-04-28T18:49:23","modified_gmt":"2011-04-28T22:49:23","slug":"data-link-14","status":"publish","type":"page","link":"https:\/\/www.bu.edu\/nf-kb\/the-gilmore-lab\/data-link-14\/","title":{"rendered":"Data Link 14"},"content":{"rendered":"

Appendix of Plasmids, Primers and Antibodies for <\/strong><\/p>\n

Garbati MR, Gilmore TD (2011) A rearranged EP300<\/em> gene in the human B-cell lymphoma cell line RC-K8 encodes a disabled transcriptional co-activator that contributes to cell growth and oncogenicity. Cancer Letters 302: 76-83<\/p>\n

pGEX-based GST Fusion Protein Bacterial Expression Vectors <\/span><\/strong><\/p>\n

pGEX KG:<\/span> Expression plasmid containing GST domain upstream of multi-cloning site (MCS)<\/p>\n

pGEX-3\u2019REL:<\/span> GST fused to the C-terminal transactivation domain sequences of wild-type REL (aa 324-587); a PCR fragment using pGEM-Hu-cRel as a template was digested with EcoRI-HindIII and subcloned into pGEX-KG digested with EcoRI-HindIII (Garbati and Gilmore, 2008)<\/p>\n

pGEX-VP16:<\/span> GST fused to the C-terminal transactivation domain sequences of VP16 (aa 452-490) (Uesugi et al., 1997; gift of Gregory Verdine, Harvard University)<\/p>\n

pcDNA-based Expression Vectors <\/span><\/strong><\/p>\n

pcDNA 3.1(-):<\/span> CMV promoter-driven expression vector (Invitrogen)<\/p>\n

pcDNA-REL:<\/span> pcDNA containing a full-length REL cDNA; an XbaI-HindIII REL fragment was subcloned into pcDNA 3.1(-) that was digested with XbaI-HindIII (Leeman et al., 2008)<\/p>\n

pCMV\u03b2-p300:<\/span> CMV-driven expression vector containing C-terminally HA-tagged human p300 (gift of Myles Brown, MIT) (Garbati et al., 2010)<\/p>\n

pCMV\u03b2-p300\u0394C:<\/span> CMV-driven expression vector containing p300\u0394C from RC-K8 cells; a PCR fragment generated using p300-For-ex9 and non-p300-gene-Hind3-Rev as primers and RC-K8 cell total cDNA as a template was digested with NdeI and HindIII and was subcloned in a three-way ligation with a (5\u2019) NotI-NdeI fragment from pCMV\u03b2-p300 into pCMV\u03b2-p300 digested with NotI and HindIII<\/p>\n

Vertebrate Reporter Plasmids <\/span><\/strong><\/p>\n

pRSV-\u03b2gal:<\/span> Contains the RSV LTR upstream of the \u03b2-galactosidase gene (gift of Douglas Faller, Boston University Medical School)<\/p>\n

3x-\u03baB-Luciferase:<\/span> pGL2-based reporter plasmid has a minimal c-fos<\/em> promoter element and three copies of the major histocompatibility complex (MHC) class \u03baB-site element (TGGGGATTCCCCA) placed upstream of the luciferase gene (Mitchell and Sugden, 1995)<\/p>\n

Retroviral Vectors <\/span><\/strong><\/p>\n

pSIREN-RetroQ:<\/span> CMV\/MSV-driven retroviral vector designed to express shRNA (Clontech, Mountain View, CA)<\/p>\n

pSIREN-p300:<\/span> pSIREN containing shRNA sequences directed against 5\u2019 sequences of EP300 <\/em>(5′-ACCAGATGCCTCGAATAA-3′; Sankar et al., 2008); inserted sequences were designed using the shRNA Sequence Designer (Clontech) with BamHI and EcoRI overhangs and subcloned into pSIREN-RetroQ digested with BamHI and EcoRI.<\/p>\n

pSIREN-control:<\/span> pSIREN containing non-targeting shRNA sequences (5\u2019-GCAAGCTGCCCGTGCCCTG-3\u2019; Scherr et al., 2003); inserted sequences were designed using the shRNA Sequence Designer (Clontech) with BamHI and EcoRI overhangs and subcloned into pSIREN-RetroQ digested with BamHI and EcoRI.<\/p>\n

pCL-10a1:<\/span> Retrovirus packaging vector (Imgenex, San Diego, CA)<\/p>\n

Oligonucleotides for Creating shRNA Retroviral Vector Plasmids <\/span><\/strong><\/p>\n

p300-shRNA-Sense:\u00a0 5\u2019-GATCCACCAGATGCCTCGAATAA<\/em>TTCAAGAGA<\/span>TTATTCGAGGCATCATCTGGT<\/em>TTTTTTACGCGTG-3\u2019<\/p>\n

p300-shRNA-Antisense:\u00a0 5\u2019-AATTCACGCGTAAAAAAACCAGATGATGCCTCGAATAA<\/em>TCTCTTGAA<\/span>TTATTCGAGGCATCATCTGGT<\/em>G-3\u2019<\/p>\n

Control-shRNA-Sense:\u00a0 5\u2019-GATCCGCAAGCTGCCCGTGCCCTG<\/em>TTCAAGAGA<\/span>CAGGGCACGGGCAGCTTGC<\/em>TTTTTTACGCGTG-3\u2019<\/p>\n

Control-shRNA-Antisense:\u00a0 5\u2019-AATTCACGCGTAAAAAAGCAAGCTGCCCGTGCCCTG<\/em>TCTCTTGAA<\/span>CAGGGCACGGGCAGCTTGC<\/em>G-3\u2019<\/p>\n

Targeting sequences are italicized. Hairpin sequences are underlined.<\/p>\n

Primers for 3\u2019RACE of the p300\u0394C cDNA from RC-K8 Cell Total cDNA <\/strong><\/span><\/p>\n

p300-RACE-ex15:\u00a0 5\u2019-GCCATTGCTGAGAAGCAGCCTTCC-3\u2019<\/p>\n

p300-RACE-ex16:\u00a0 5\u2019-CCCAGTCATCTCCGGCTCCAGGAC-3\u2019<\/p>\n

3\u2019RACE CDS Primer A (Clontech):\u00a0 5\u2019-AAGCAGTGGTATCAACGCAGAGTAC(T)30<\/sub>VN-3\u2019<\/p>\n

(N = A, C, G, or T; V = A, G, or C)<\/p>\n

Universal Primer A Mix (Clontech):<\/p>\n

UPM Long:\u00a0 5\u2019-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3\u2019<\/p>\n

UPM Short:\u00a0 5\u2019-CTAATACGACTCACTATAGGGC-3\u2019<\/p>\n

Nested Universal Primer A (Clontech):\u00a0 5\u2019-AAGCAGTGGTATCAACGCAGAGT-3\u2019<\/p>\n

Primers for PCR Amplification for Subcloning of the p300\u0394C 3\u2019 End into pCMV\u03b2-p300 <\/span><\/strong><\/p>\n

p300-For-ex9:\u00a0 5\u2019-GCTTTAAAAGACAGACGGATGG-\u20183<\/p>\n

non-p300-gene-Hind3-Rev:\u00a0 5\u2019-CCCAAGCTT<\/span>CAAAGCCACAGAAATTGCATCTC-3\u2019<\/p>\n

Restriction sites are underlined. <\/em><\/p>\n

<\/strong><\/p>\n

Primers for RT-PCR and PCR of Genomic DNA of p300\u0394C for DNA Sequencing <\/span><\/strong><\/p>\n

p300-For-ex17:\u00a0 5\u2019-ACTACGACAGGCACTGATGC-3\u2019<\/p>\n

non-p300-gene-Rev:\u00a0 5\u2019-CATCTGCTCAATGACCACAG-3\u2019<\/p>\n

Antisera <\/span><\/strong><\/p>\n

Western Blotting <\/strong><\/p>\n

rabbit anti-p300 (N-terminal, sc-584, Santa Cruz Biotechnology, Santa Cruz, CA) used at 1:200<\/p>\n

rabbit anti-\u03b2-tubulin (sc-9104, Santa Cruz Biotechnology) used at 1:500<\/p>\n

Indirect Immunofluoresence <\/strong><\/p>\n

rabbit anti-p300 (N-terminal, sc-584, Santa Cruz Biotechnology) used at 1:40<\/p>\n

rabbit IgG (whole molecule) FITC-conjugated (F9887, Sigma, St. Louis, MO) used at 1:80<\/p>\n

References <\/span><\/strong><\/p>\n

Garbati MR, Gilmore TD (2008) Ser484 and Ser494 in REL are the major sites of IKK phosphorylation in vitro:\u00a0 evidence that IKK does not directly enhance GAL4-REL transactivation. Gene Expression 14:195-205<\/p>\n

Garbati M, Al\u00e7o G, Gilmore TD. 2010. The histone acetyltransferase p300 co-activator is functionally inactivated in the human diffuse large B-cell lymphoma cell line RC-K8. Cancer Letters 291:237-245<\/p>\n

Leeman JR, Weniger MA, Barth TF, Gilmore TD (2008) Deletion analysis and alternative splicing define a transactivation inhibitory domain in human oncoprotein REL. Oncogene 27:6770-6781<\/p>\n

Mitchell T, Sugden B (1995) Stimulation of NF-\u03baB-mediated transcription by mutant derivatives of the latent membrane protein of Epstein-Barr virus. Journal of Virology 65:2968-2976<\/p>\n

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual.<\/em> Cold \u00a0Spring Harbor, NY, Cold Spring Harbor Press<\/p>\n

Sankar N, Baluchamy S, Kadeppagari R-K, Singhal G, Weitzman S (2008) p300 provides a corepressor function by cooperating with YY1 and HDAC3 to repress c-Myc<\/em>. Oncogene 27:5717-5728<\/p>\n

Scherr M, Battmer K, Ganser A, Eder M (2003) Modulation of gene expression by lentiviral-mediated delivery of small interfering RNA. Cell Cycle 2:251-257<\/p>\n

Uesugi M, Nyanguile O, Lu H, Levine AJ, Verdine GL (1997) Induced alpha helix in the VP16 activation domain upon binding to a human TAF. Science 277:1310-1313<\/p>\n","protected":false},"excerpt":{"rendered":"

Appendix of Plasmids, Primers and Antibodies for Garbati MR, Gilmore TD (2011) A rearranged EP300 gene in the human B-cell lymphoma cell line RC-K8 encodes a disabled transcriptional co-activator that contributes to cell growth and oncogenicity. Cancer Letters 302: 76-83 pGEX-based GST Fusion Protein Bacterial Expression Vectors pGEX KG: Expression plasmid containing GST domain upstream […]<\/p>\n","protected":false},"author":4258,"featured_media":0,"parent":337,"menu_order":10,"comment_status":"closed","ping_status":"open","template":"","meta":[],"_links":{"self":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/571"}],"collection":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/users\/4258"}],"replies":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/comments?post=571"}],"version-history":[{"count":3,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/571\/revisions"}],"predecessor-version":[{"id":608,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/571\/revisions\/608"}],"up":[{"embeddable":true,"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/pages\/337"}],"wp:attachment":[{"href":"https:\/\/www.bu.edu\/nf-kb\/wp-json\/wp\/v2\/media?parent=571"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}