Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamH I and Bcl I.

 

a) BamH I, cleaves after the first G:

 

5’ GGATCC 3’

3’ CCTAGG 5’

 

Does cleavage by BamH I result in a 5’ or 3’ overhang? What is the sequence of this overhang?

 

 

 

b) Bcl I cleaves after the first T:

 

5’ TGATCA 3’

3’ ACTAGT 5’

 

Does cleavage by Bcl I result in a 5’ or 3’ overhang? What is the sequence of this overhang?

 

 

 

c) Given the DNA shown below …

 

5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’

3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’

 

i) If this DNA was cut with BamH I, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments.

 

 

ii) If the DNA shown on the previous page in (c) was cut with Bcl I, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments.

 

 

d) You can ligate a restriction fragment produced in (c, i) to one produced in (c,

 

ii). Write out the sequence of the resulting fragment.

 

 

 

e) Could you cut the fragment from (d) with either BamH I or Bcl I? Explain.